← Flecto🤖 Agent Ready
Frontiers in Oncology

Studies on the Functionality of the TC-NER ERCC6-M1097V Protein Variant Frequently Found in Louisiana Patients with PCa upon UV Damage

Oluwatobi Ogundepo & Arrigo De Benedetti*

Department of Biochemistry and Molecular Biology, Louisiana State University Health Shreveport, LA, United States

Published February 3, 2026 · DOI: 10.3389/fonc.2025.1679379

ADT CDDP CPDs HRR CDDP-ISLs mCRPC MMR PCa
Read on PMC ↗

Abstract

ERCC6, also known as CSB (Cockayne Syndrome B), is a key protein involved in transcription-coupled nucleotide excision repair (TC-NER), a DNA repair process that removes lesions blocking RNA polymerase. ERCC6 has multifaceted roles including chromatin remodeling, transcription regulation, oxidative stress response, and coordination with other DNA repair proteins. Mutations in ERCC6 lead to Cockayne Syndrome and other neurodegenerative disorders, but some variants, such as M1097V, have been associated with cancer risk, particularly prostate cancer (PCa) in African Americans (AAs) in Louisiana. Recent studies have explored the functional impact of ERCC6 variants in PCa, especially among AAs, who face higher incidence and more aggressive forms of the disease. A notable finding is that the M1097V variant increases cellular tolerance to UV damage, suggesting not only a possible evolutionary benefit but also a potential risk for mutagenesis when exposed to complex environmental carcinogens. Given the high mutation burden in mismatch repair (MMR) and NER genes observed in AA patients with PCa, a synthetic lethality strategy targeting both TC-NER and homologous recombination repair (HRR) pathways could be effective, including combining agents like CDDP (cisplatin) with inhibitors of RAD54, such as J54.

What is TC-NER?

Transcription-Coupled Nucleotide Excision Repair (TC-NER) is one of the cell's "spell-check" systems for DNA. When a cell is reading a gene (transcription), it can get stuck if there's damage in the DNA. TC-NER is the emergency repair crew that rushes in to fix the damage so the cell can keep reading its genes. Think of it like a road crew that fixes potholes specifically on highways that cars are currently driving on, rather than checking every road in the city.

Introduction

21%

M1097V frequency in African American PCa patients

1%

M1097V frequency in Caucasian PCa patients

Prostate cancer (PCa) is the most commonly diagnosed non-cutaneous malignancy and the second-leading cause of cancer-related death among men in the United States. African American (AA) men bear a disproportionate burden of this disease compared to men of European ancestry, exhibiting higher incidence rates, earlier onset, and increased mortality from treatment-refractory disease. While socioeconomic and healthcare access disparities contribute to these differences, accumulating evidence suggests that biological factors, including genomic and molecular alterations, may play a critical role in driving the aggressive phenotype observed in AA patients.

Why do PCa disparities matter? Prostate cancer affects African American men at a much higher rate than Caucasian men — not just in incidence, but in aggressiveness and mortality. While social and economic factors play a role, this paper investigates a specific genetic explanation: a mutation in a DNA repair gene that is found 21 times more frequently in AA patients. Understanding these biological differences could lead to targeted therapies specifically designed for the most affected populations.

The DNA damage response and repair pathways (DDRR), collectively known as the "repairome," are essential for maintaining genomic stability and preventing malignant transformation. In PCa, alterations in key DNA repair genes—such as BRCA1, BRCA2, ATM, and MLH1—have been associated with tumor progression, poor prognosis, and sensitivity to targeted therapies, including PARP inhibitors and platinum-based agents. The success of PARPi for metastatic castration-resistant prostate cancer (mCRPC) is defining new treatment options, and while cisplatin-based therapy is not currently the treatment of choice for PCa, current trends suggest that lower dosing combined with DNA repair inhibitors could be quite effective.

The "Repairome" — Your Cell's Repair Toolkit

Your cells have an entire toolkit of DNA repair mechanisms, collectively called the repairome. These include:

  • NER (Nucleotide Excision Repair): Removes bulky DNA damage like UV-induced lesions
  • MMR (Mismatch Repair): Fixes base-pairing errors made during DNA copying
  • HRR (Homologous Recombination Repair): Fixes double-strand breaks using the sister chromosome as a template
  • BER (Base Excision Repair): Fixes small, non-helix-distorting lesions

When these systems are defective, cancer risk increases dramatically. PARP inhibitors (like olaparib) exploit these defects by making cancer cells unable to repair DNA, causing them to die — a concept called synthetic lethality.

ERCC6/CSB: A Multifunctional DNA Repair Protein

  • Primary function: Mediates the dislodging of transcription Elongation Complexes stuck at DNA-distorting lesions
  • Anti-apoptotic factor: Tips the cell towards proliferation and survival
  • Loss of function: Results in cell cycle arrest, senescence via p53 interaction, and Cockayne syndrome (progeria)
  • M1097V variant: Found at 21% frequency in AA-PCa (vs 1% in Caucasians), identified as a significant risk factor in meta-analyses of multiple cancer types worldwide

Study Objectives

In this study, the M1097V genomic mutation was introduced via CRISPR/Cas9 in a panel of common PCa cell lines, including PCa2 cells derived from an AA patient. The consequences for the repair of lesions requiring TC-NER (UV and cisplatin resistance) were investigated as a first assessment of how this mutant protein might interact with environmental exposures. In Louisiana, PCa disparity is far more prevalent, with higher incidence and worse overall survival attributed to both genetic components and dietary habits, compounded by much greater health risks from a regional toxic environment.

Materials & Methods

CRISPR/Cas9 knock-in is a gene editing technique where the Cas9 enzyme cuts DNA at a specific location (guided by the guide RNA), and the cell's own repair machinery uses a provided donor DNA template to introduce the desired mutation. It is like a molecular "find and replace" for specific letters in the DNA code.

CRISPR/Cas9 Site-Directed Mutagenesis

Guide RNA, donor DNA, and TrueCut Cas9 protein were designed using ThermoFisher TrueDesign. Cells were transfected at 70% confluency using CRISPRMAX reagent in Opti-MEM. After 48 hours, single-cell clones were created and screened.

Plasmid Vector SDM

The M1097V mutation was introduced in OriGene expression vector RC219020 using the QuickChangeII SDM kit. Transient transfections were carried out with Lipofectamine-3000 for 48 hours.

Gel Electrophoresis

1% agarose gels with EtBr at 80V. PCR-RFLP with Hin1II (NlaIII) for clone verification. Imaged with BIORAD ChemiDoc system, followed by confirmatory sequencing.

Dot Blot (DNA Southwestern Blot)

50,000 cells plated, UV-exposed for 30 seconds, then recovered at different time points. Lysed, dot blotted, and probed with anti-CPD antibody to detect cyclobutane pyrimidine dimers.

Proliferation Assay

Cells seeded in 96-well plates at 50% confluency, exposed to various UV doses. Growth monitored via IncuCyte S3 with phase contrast imaging every 4 hours.

ATPase Assay

Performed with ADP-Hunter using ~50 ng of immunopurified ERCC6 and ±50 ng plasmid DNA. Kinetics measured at steady state after 15-minute pre-incubation at 37°C.

Statistical Analysis

GraphPad Prism 9 for statistical analysis. Results as mean ± SEM. Student's t-test for two-group comparisons. Significance: *p < 0.05, **p < 0.01, ***p < 0.001.

ERCC6 Protein Structure & Conservation

ERCC6 is an essential, highly conserved gene from yeast to mammals. Given its essentiality, mutations are rare and almost absent from the PCa TCGA-500 database. Therefore, the unusual frequency of the M1097V variant, especially in African Americans, may be a peculiarity of the Louisiana population. Starting from the genomic site-directed mutagenesis work, the M1097V mutations were introduced in multiple cell lines via CRISPR-mediated recombination, yielding hetero- and homozygous (bi-allelic) mutants.

Figure 1: ERCC6 protein domain structure and evolutionary conservation
Figure 1: (A) ERCC6 protein domain structure showing N-terminal, ATPase binding domain, helicase C-terminal domain, and location of M1097V mutation. (B) Evolutionary conservation of ERCC6 across species (human, mouse, plant, yeast). (C) Schematic of ERCC6 functional regions including N-CSB, M-CSB, and C-CSB domains.

CRISPR/Cas9 M1097V Knock-In

As there are no available cell lines carrying the M1097V mutation, CRISPR-mediated editing was used to introduce this variant. The M1097V knock-in was generated and validated in multiple prostate cancer cell lines including C4-2B, DU145, PC3, and PCa2 (an AA patient-derived line). Both heterozygous and homozygous (bi-allelic) clones were obtained and confirmed by PCR-RFLP and sequencing.

Table 1: Primers and CRISPR components used for M1097V knock-in
ComponentSequence / Value
Guide RNAGTTACATTACTACTCATGTG
Donor DNACTAATCGAAGTGATCCTTTGAAAGATGA CCCTCACGTGAGTAGTAATGTAACTAGCA ATGATAGGCTTGGAGA
ERCC6_SEQ_FWD_P1GTTCAGACACCCAAATGCCA
ERCC6_SEQ_FWD_P2AAACGCAAGAAGTTCCCTGC
ERCC6_SEQ_REV_P1AGGGTCTCTTCTTCTGCCAC
ERCC6_SEQ_REV_P2CTTCTGTTTGAGCCTGGCTG
Target SequenceGTTACATTACTACTCATGTG
PAMAGG
Score97.09
Genomic Locationchr10[49470654]
Figure 2: CRISPR/Cas9 M1097V knock-in generation and validation
Figure 2: Generation and validation of M1097V knock-in using CRISPR/Cas9. (A) Schematic of M1097 vs M1097V nucleotide and amino acid sequences. (B) CRISPR/Cas9 editing workflow with homology-directed repair. (C) PCR amplification and Hin1II cleavage. (D) Plasmid confirmation from OriGene. (E) Clone confirmation via PCR-RFLP across cell lines.

UV Sensitivity & CPD Repair

Key Finding

Against the initial hypothesis, the M1097V mutation conferred greater resistance to UV doses and faster resolution of UV-induced CPDs. An "overactive" TC-NER mechanism can be more mutagenic under the right conditions than an underactive, deficient one—the faster repair paradoxically increases the chance of introducing mismatches during strand replacement.

The Paradox of "Better" DNA Repair

This is the study's most surprising and counterintuitive finding. You might expect that a mutation in a DNA repair protein would make repair worse, making cells more vulnerable to DNA damage. But the M1097V variant actually makes repair faster.

Why could faster repair be bad? Imagine a construction crew rushing to fix a road. If they work too fast, they might use the wrong materials or leave imperfections. Similarly, when TC-NER works too quickly, the DNA polymerase that fills in the repaired gap has a higher chance of inserting the wrong base — especially when there are oxidative lesions nearby (like 8-oxoguanine). These mismatches can lead to mutations that drive cancer progression.

This is why the authors call it an "overactive" TC-NER mechanism that can be more mutagenic than a deficient one.

UV and CDDP sensitivity were assessed in the ERCC6-mutant derivative clones. Surprisingly, the M1097V mutation conferred somewhat greater resistance to UV doses and faster resolution of UV-induced cyclobutane pyrimidine dimers (CPDs). Interestingly, the PCa2 line from an AA patient, which carries a different ERCC6 mutation (Y776C), also showed remarkable activity in CPD removal compared to all other lines. This UV resistance clearly depends on ERCC6, as siRNA knockdown drastically reduced UV survival. Control NT1-Nek1-KO cells showed almost no DNA repair (CPD removal) even after one full day.

During NER strand replacement at the incision site, there is a significant chance of introducing mismatches if the bulky lesions are elevated, particularly in the presence of 8-oxoguanine (8OG). Mismatch repair (MMR) can actually be more mutagenic than NER-mediated correction of bulky lesions due to the lack of precise strand discrimination. Hence, UV sensitivity (orchestrated via CPD removal) and CDDP sensitivity (via complex combination pathways) are not overlapping as one might expect.

Figure 3: UV sensitivity proliferation assays
Figure 3: UV sensitivity proliferation assays. (A, B) Confluency changes in DU145-G3 and PC3-A8 cells after 0–15 seconds UV exposure. (C, D) Growth rate comparisons (ΔConfluency/Time) showing statistically significant differences (*p < 0.05, **p < 0.01, ***p < 0.001).
Figure 4: CPD removal dot blot
Figure 4: Dot blot (DNA Southwestern blot) showing CPD removal kinetics. Time points: −UV, 0, 6, 12, 18, and 24 hours post-UV. M1097V mutants (D3, A8, G3) and PCa2 demonstrate faster CPD removal compared to wild-type and NT1-Nek1KO controls.
Figure 5: ERCC6 siRNA knockdown proliferation assays and Western blot
Figure 5: ERCC6 dependency validation. (A–D) Proliferation assays of parental cells treated with ERCC6 siRNA and exposed to 5s UV, showing that ERCC6 knockdown drastically reduces UV survival. (E) Western blot confirming ERCC6 protein knockdown at various siRNA concentrations.

Cisplatin Sensitivity

Unlike the UV resistance phenotype, the response to cisplatin (CDDP) showed a different pattern. UV sensitivity (orchestrated via CPD removal) and CDDP sensitivity (via complex combination pathways including NER and HRR) are not overlapping mechanisms. CSB may be beneficial in UV damage repair but not necessarily in cisplatin-induced damage. Importantly, this means that the ERCC6 variants found in AA-PCa can still be targeted by an NER and HRR combination strategy, as these are expected to yield more double-strand breaks (DSBs) during cisplatin inter-/intrastrand crosslinks (CDDP-ISLs) processing.

UV damage ≠ Cisplatin damage: While both involve DNA lesions repaired partly by NER, they are processed very differently. UV creates cyclobutane pyrimidine dimers (CPDs) — localized kinks in DNA. Cisplatin creates inter- and intrastrand crosslinks (ISLs) that link different parts of DNA together, requiring both NER and homologous recombination repair (HRR) to fix. This is why M1097V can make cells better at handling UV damage while still being targetable by cisplatin-based therapy.

Figure 6: Cisplatin sensitivity proliferation assays
Figure 6: Cisplatin (CDDP) sensitivity assays. (A–D) Proliferation of DU145, G3, PC3, and A8 cells pretreated with 1, 5, and 15 µg/mL cisplatin for 6 hours, then monitored over several days. The data show that cisplatin sensitivity is mechanistically distinct from UV sensitivity.

ATPase Activity

ATPase activity of purified ERCC6 wild-type and M1097V mutant was compared using the ADP-Hunter assay. The M1097V variant showed subtle differences in DNA-dependent ATPase kinetics. These complex ATPase cycles—some DNA-independent—promote large structural rearrangements while displacing the stuck transcription elongation complex. Detailed biochemical studies, similar to those done with the E. coli ERCC6 paralog Mfd, will be needed to fully characterize the impact of this mutation on enzymatic function.

ATPase activity is a measure of how efficiently a protein uses ATP (the cell's energy currency) to do mechanical work. ERCC6/CSB is a molecular motor that uses ATP energy to physically push RNA polymerase off damaged DNA. The ADP-Hunter assay measures this by tracking how much ATP is consumed over time.

Figure 7: ATPase activity of purified ERCC6
Figure 7: ATPase activity of purified ERCC6. Left: ATPase kinetics (RLU vs. time) for wild-type and M1097V, with and without DNA. Right: Western blot confirming purified protein (Mock IP, CSB-wt-Flag, CSB-M1097V-Flag).

Discussion

Cockayne Syndrome is a rare genetic disorder caused by ERCC6 mutations that completely disable the protein. Patients experience premature aging, neurodegeneration, and growth failure. The M1097V variant studied here is not nearly as severe — it's a subtle change that alters protein function rather than eliminating it, which is why its effects are more nuanced.

Multifaceted Roles of ERCC6/CSB

  • TC-NER: Detects and initiates repair of DNA lesions blocking transcription. When RNA Pol II stalls at UV-induced CPDs, ERCC6 recruits repair factors to remove the lesion and resume transcription.
  • Chromatin Remodeling: Possesses ATP-dependent chromatin remodeling activity, crucial for providing repair machinery access to DNA in compact chromatin regions.
  • Transcription Regulation: Regulates gene expression by interacting with transcription machinery, influencing RNA Pol I and Pol II pausing and restart.
  • Repair Coordination: Interacts with TC-NER factors including CSA (ERCC8), XPG, TFIIH, and UVSSA to coordinate the repair process.
  • Oxidative Damage: Implicated in repair of oxidative DNA damage, helping maintain mitochondrial function and cellular redox balance under stress.
  • Disease Relevance: Mutations cause Cockayne Syndrome, a rare autosomal recessive disorder with growth failure, neurodegeneration, and premature aging.

M1097V: From Cancer Risk to Therapeutic Target

While loss-of-function mutations cause severe syndromes, most missense variants’ functions have not been well studied. The M1097V polymorphism has been identified as a significant risk factor for cancer in meta-analyses of several cancer types worldwide, and was recently noted for its unusually high prevalence in AA-PCa (21% vs 1% in Caucasians). The faster CPD repair activity in M1097V mutants forced a rethinking of the initial hypothesis: an "overactive" TC-NER mechanism can paradoxically be more mutagenic under certain conditions because of increased mismatches during rapid strand replacement.

Synthetic Lethality Strategy: CDDP + J54

The ERCC6 variants found in AA-PCa can still be successfully targeted by an NER and HRR combination strategy—for example, with a synthetic lethal combination of cisplatin (CDDP) and J54 (a RAD54 inhibitor). These combinations are expected to yield more double-strand breaks during cisplatin crosslink processing, offering an effective therapeutic approach even against cells with enhanced TC-NER activity.

Synthetic Lethality Explained

Synthetic lethality is like taking away both exits in a burning building. Cancer cells with certain DNA repair defects can survive because they rely on backup repair pathways. If you block the backup pathway too, the cell has no way to fix DNA damage and dies.

  • CDDP (cisplatin) creates DNA crosslinks that require NER + HRR to repair
  • J54 inhibits RAD54, a key enzyme in homologous recombination repair (HRR)
  • Together, they trap cancer cells with no functional repair pathway available

This approach could be especially valuable for African American PCa patients whose tumors carry ERCC6 variants, potentially offering an alternative to androgen deprivation therapy (ADT) — a treatment with significant quality-of-life side effects.

Therapeutic Implications & Future Directions

AAs are at higher risk for developing PCa and have more aggressive, treatment-refractory disease. Since most PCa therapies focus on AR signaling inhibition, combination approaches targeting DNA repair could bypass or eliminate the need for androgen deprivation therapy (ADT) and its significant side effects. This is especially relevant for neuroendocrine prostate cancer (NEPC) cases, which are more common in AA patients and do not respond to ADT/ARSI.

Endogenous ERCC6 expression is quite low and further complicated by the ERCC6-PGBD3 transposon fusion gene. Future studies will include the S636N mutation (also found only in Louisiana PCa), more detailed ATPase analyses, and investigation of the complex biochemical cycles underlying ERCC6-mediated transcription complex displacement.

Conclusions

This study underscores the critical and multifaceted role of ERCC6/CSB in DNA repair and transcription regulation, particularly through the TC-NER pathway. The M1097V variant enhances UV resistance in PCa cells, suggesting a possible evolutionary adaptation with modern therapeutic implications. This variant, along with other ERCC6 alterations found predominantly in AA patients with PCa, may explain differences in treatment response. Synthetic lethality approaches targeting both NER and HRR pathways (e.g., CDDP + J54) could offer personalized alternatives to androgen deprivation therapy, representing a promising direction for addressing PCa disparities.

Additional Information

Author Contributions

OO: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Validation, Writing – review & editing, Writing – original draft. AD: Conceptualization, Formal Analysis, Funding acquisition, Investigation, Project administration, Supervision, Validation, Writing – original draft, Writing – review & editing.

Funding

Chancellor Award 2024 to AB.

Acknowledgments

The authors thank the INLET facility of LSU Health Shreveport (RRID: SCR_024775), especially Ana Maria Dragoi and Brian Latimer for their assistance in working with the IncuCyte.

Conflict of Interest

The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Data Availability

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

References (35)
  1. Fan T, Shi T, Sui R, Wang J, Kang H, Yu Y, et al. The chromatin remodeler ERCC6 and the histone chaperone NAP1 are involved in apurinic/apyrimidinic endonuclease-mediated DNA repair. Plant Cell. (2022).
  2. Spyropoulou Z, Papaspyropoulos A, Lagopati N, Myrianthopoulos V, Georgakilas AG, Fousteri M, et al. Cockayne syndrome group B (CSB): the regulatory framework governing the multifunctional protein and its plausible role in cancer. Cells. (2021).
  3. Kakarla M, ChallaSivaKanaka S, Hayward SW, Franco OE. Race as a contributor to stromal modulation of tumor progression. Cancers. (2021) 13:2656.
  4. Teng PC, Huang SP, Liu CH, Lin TY, Cho YC, Lai YL, et al. Identification of DNA damage repair-associated prognostic biomarkers for prostate cancer using transcriptomic data analysis. Int J Mol Sci. (2021).
  5. Schmid S, Omlin A, Higano C, Sweeney C, et al. Activity of platinum-based chemotherapy in patients with advanced prostate cancer with and without DNA repair gene aberrations. JAMA Netw Open. (2020).
  6. Zhang W, Van Gent DC, Incrocci L, Van Weerden WM, Nonnekens J. Role of the DNA damage response in prostate cancer formation, progression and treatment. Prostate Cancer Prostatic Dis. (2020) 23:24-37.
  7. Banks P, Xu W, Murphy D, James P, Sandhu S. Relevance of DNA damage repair in the management of prostate cancer. Curr Probl Cancer. (2017) 41:287-301.
  8. de Bono J, Mateo J, Fizazi K, Saad F, Shore N, Sandhu S, et al. Olaparib for metastatic castration-resistant prostate cancer. N Engl J Med. (2020) 382:2091-102.
  9. Abida W, Campbell D, Patnaik A, Shapiro JD, et al. Non-BRCA DNA damage repair gene alterations and response to the PARP inhibitor rucaparib in metastatic castration-resistant prostate cancer. JCO. (2020).
  10. Perše M. Cisplatin mouse models: treatment, toxicity and translatability. Biomedicines. (2021) 9:1406.
  11. Yadav S, Anbalagan M, Baddoo M, et al. Somatic mutations in the DNA repairome in prostate cancers in African Americans and Caucasians. Oncogene. (2020) 39:4307-21.
  12. Chang C-H, Chiu C-F, Wang H-C, et al. Significant association of ERCC6 single nucleotide polymorphisms with bladder cancer susceptibility in Taiwan. Anticancer Res. (2009).
  13. Forrest IS, Chaudhary K, Vy HMT, et al. Genetic pleiotropy of ERCC6 loss-of-function and deleterious missense variants. Cell Genom. (2023).
  14. Lin X, Wu Y, Li Q, et al. Genetic association of ERCC6 rs2228526 polymorphism with the risk of cancer: evidence from a meta-analysis. Biomed Res Int. (2022) 2022:2662666.
  15. Su LJ, Arab L, Steck SE, Fontham ET, et al. Obesity and prostate cancer aggressiveness among African and Caucasian Americans in a population-based study. Cancer Epidemiol Biomarkers Prev. (2011).
  16. Baurick T, Younes L, Meiners J. Welcome to "Cancer Alley" where toxic air is about to get worse. ProPublica. (2019).
  17. Ogundepo O, Chikhale R, Lu C, Li S, De Benedetti A. NEK1 Phosphorylation Modulates ERCC6 in Transcription-Coupled Nucleotide Excision Repair. Preprints. (2025).
  18. Khalil MI, Ghosh I, Singh V, Chen J, Zhu H, De Benedetti A. NEK1 phosphorylation of YAP promotes its stabilization and transcriptional output. Cancers. (2020) 12:3666.
  19. Basei FL, Meirelles GV, Righetto GL, et al. New interaction partners for Nek4.1 and Nek4.2 isoforms: from the DNA damage response to RNA splicing. Proteome Sci. (2015).
  20. Putnam CD. Strand discrimination in DNA mismatch repair. DNA Repair (Amst). (2021) 105:103161.
  21. Bhoir S, Ogundepo O, Yu X, Shi R, De Benedetti A. Exploiting TLK1 and cisplatin synergy for synthetic lethality in androgen-insensitive prostate cancer. Biomedicines. (2023) 11:2987.
  22. Sarker AH, Tsutakawa SE, Kostek S, et al. Recognition of RNA polymerase II and transcription bubbles by XPG, CSB, and TFIIH: insights for transcription-coupled repair and Cockayne Syndrome. Mol Cell. (2005).
  23. Ghosh I, Kwon Y, Shabestari AB, et al. TLK1-mediated RAD54 phosphorylation spatio-temporally regulates Homologous Recombination Repair. Nucleic Acids Res. (2023).
  24. Goyal N, Rossi MJ, Mazina OM, et al. RAD54 N-terminal domain is a DNA sensor that couples ATP hydrolysis with branch migration of Holliday junctions. Nat Commun. (2018).
  25. Rizvi N, Hamilton R, Wu X-C, et al. Mediation analysis to investigate differences in prostate cancer diagnosis stage through environmental risk factors in Louisiana. Curr Oncol. (2023).
  26. Loeb LA. A mutator phenotype in cancer. Cancer Res. (2001) 61:3230-9.
  27. Singh V, Bhoir S, Chikhale RV, et al. Generation of phenothiazine with potent anti-TLK1 activity for prostate cancer therapy. iScience. (2020) 23:101474.
  28. Singh V, Jaiswal PK, Ghosh I, et al. Targeting the TLK1/NEK1 DDR axis with Thioridazine suppresses outgrowth of androgen independent prostate tumors. Int J Cancer. (2019).
  29. Singh V, Jaiswal PK, Ghosh I, et al. The TLK1-Nek1 axis promotes prostate cancer progression. Cancer Lett. (2019) 453:131-41.
  30. Hinata N, Fujisawa M. Racial differences in prostate cancer characteristics and cancer-specific mortality: an overview. World J Mens Health. (2022) 40:217-27.
  31. Eule CJ, Hu J, Al-Saad S, et al. Outcomes of second-line therapies in patients with metastatic de novo and treatment-emergent neuroendocrine prostate cancer. Clin Genitourin Cancer. (2023).
  32. Xu R, Zhu S, Zhang W, et al. A dual approach with organoid and CRISPR screening reveals ERCC6 as a determinant of cisplatin resistance in osteosarcoma. Adv Sci. (2025).
  33. Corn PG, Heath EI, Zurita A, et al. Cabazitaxel plus carboplatin for the treatment of men with metastatic castration-resistant prostate cancers. Lancet Oncol. (2019).
  34. Chou F-J, Lin C, Tian H, et al. Preclinical studies using cisplatin/carboplatin to restore the Enzalutamide sensitivity via degrading the androgen receptor splicing variant 7 (AR-V7). Cancers. (2020).
  35. Kang JY, Llewellyn E, Chen J, et al. Structural basis for transcription complex disruption by the Mfd translocase. eLife. (2021) 10:e62117.

B2B Content

Any content, beautifully transformed for your organization

PDFs, videos, web pages — we turn any source material into production-quality content. Rich HTML · Custom slides · Animated video.

View Services Contact Us